ID: 1186264181_1186264190

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1186264181 1186264190
Species Human (GRCh38) Human (GRCh38)
Location X:7813914-7813936 X:7813949-7813971
Sequence CCTCAAACCCACCTTTCTGAGGA AGTTTTTAAGGGAATTTTGGTGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 23, 3: 259, 4: 1006}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!