ID: 1186266907_1186266918

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1186266907 1186266918
Species Human (GRCh38) Human (GRCh38)
Location X:7843008-7843030 X:7843052-7843074
Sequence CCATGTCCTGATGGTGCTTTGTG GCCCAGGGCGACCATTGGCTGGG
Strand - +
Off-target summary {0: 3, 1: 3, 2: 0, 3: 23, 4: 256} {0: 1, 1: 2, 2: 3, 3: 8, 4: 131}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!