ID: 1186324589_1186324603

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1186324589 1186324603
Species Human (GRCh38) Human (GRCh38)
Location X:8465232-8465254 X:8465283-8465305
Sequence CCCCCCGCCCCCGACTTCATCCG TAAGGCCTTCCTTCCCGCCCAGG
Strand - +
Off-target summary {0: 6, 1: 0, 2: 0, 3: 17, 4: 189} {0: 3, 1: 3, 2: 0, 3: 18, 4: 122}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!