ID: 1186469766_1186469770

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1186469766 1186469770
Species Human (GRCh38) Human (GRCh38)
Location X:9812101-9812123 X:9812139-9812161
Sequence CCAGTAACAGGCCAAGAGCTTTA AGTTGTCTGCAGAAGATGGCAGG
Strand - +
Off-target summary No data {0: 3, 1: 193, 2: 193, 3: 120, 4: 281}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!