ID: 1186801045_1186801051

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1186801045 1186801051
Species Human (GRCh38) Human (GRCh38)
Location X:13092647-13092669 X:13092695-13092717
Sequence CCTACAACGCACAGCACAGCTCC CCCTGCCCTCAAGTCTTGGTTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 63, 3: 330, 4: 1021} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!