ID: 1187136552_1187136558

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1187136552 1187136558
Species Human (GRCh38) Human (GRCh38)
Location X:16552708-16552730 X:16552750-16552772
Sequence CCATACCACCTCAGTTGGGGGAG CATTGTTGAGTAATTCTGGATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 7, 4: 138}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!