ID: 1187698188_1187698206

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1187698188 1187698206
Species Human (GRCh38) Human (GRCh38)
Location X:21941170-21941192 X:21941219-21941241
Sequence CCGCGCTCCCACGCGGGCTCGCC CCCGGGCTGCCGGGCGCGGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 162} {0: 1, 1: 1, 2: 4, 3: 50, 4: 507}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!