ID: 1187698204_1187698220

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1187698204 1187698220
Species Human (GRCh38) Human (GRCh38)
Location X:21941218-21941240 X:21941253-21941275
Sequence CCCCGGGCTGCCGGGCGCGGGCG GACGAGGGTTGCAGGGACTGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 37, 4: 328} {0: 1, 1: 0, 2: 3, 3: 18, 4: 232}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!