ID: 1187704423_1187704426

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1187704423 1187704426
Species Human (GRCh38) Human (GRCh38)
Location X:21995274-21995296 X:21995296-21995318
Sequence CCTAAGGAAGTGCAGGTAGCTAA ACAGCTTGGTGTGGTGTGTGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 41, 4: 268}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!