ID: 1189154882_1189154887

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1189154882 1189154887
Species Human (GRCh38) Human (GRCh38)
Location X:38746713-38746735 X:38746752-38746774
Sequence CCCAGTAACAGGCCAAGAACTGT AGTTATTTGCAGAAGATGGCAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!