ID: 1190044550_1190044555

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1190044550 1190044555
Species Human (GRCh38) Human (GRCh38)
Location X:47101509-47101531 X:47101534-47101556
Sequence CCCAGTTTATCACATGGAGGAGG GAAGAGTGATGGAACCCCATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 129} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!