ID: 1190051974_1190051979

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1190051974 1190051979
Species Human (GRCh38) Human (GRCh38)
Location X:47157231-47157253 X:47157253-47157275
Sequence CCGCGGAGAATTTCTTGAGCAAG GGGCCTCTGGACCACGGTGTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 96} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!