ID: 1190285287_1190285299

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1190285287 1190285299
Species Human (GRCh38) Human (GRCh38)
Location X:48957428-48957450 X:48957461-48957483
Sequence CCGCCGCCCACGCCCGTGCCGCC CCCACACCTCCGCCGCGCCGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 88, 4: 824} {0: 1, 1: 0, 2: 2, 3: 13, 4: 160}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!