ID: 1190285288_1190285304

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1190285288 1190285304
Species Human (GRCh38) Human (GRCh38)
Location X:48957431-48957453 X:48957469-48957491
Sequence CCGCCCACGCCCGTGCCGCCGCC TCCGCCGCGCCGCGGCGCCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 80, 4: 883} {0: 1, 1: 0, 2: 3, 3: 19, 4: 209}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!