ID: 1190285294_1190285319

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1190285294 1190285319
Species Human (GRCh38) Human (GRCh38)
Location X:48957449-48957471 X:48957502-48957524
Sequence CCGCCGCCCACGCCCACACCTCC GGGCGGCGGCGGCTCGTTGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 141, 4: 1378} {0: 1, 1: 1, 2: 3, 3: 30, 4: 204}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!