ID: 1190285300_1190285317

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1190285300 1190285317
Species Human (GRCh38) Human (GRCh38)
Location X:48957462-48957484 X:48957499-48957521
Sequence CCACACCTCCGCCGCGCCGCGGC CCCGGGCGGCGGCGGCTCGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 10, 3: 137, 4: 421} {0: 1, 1: 0, 2: 8, 3: 37, 4: 216}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!