ID: 1190285301_1190285324

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1190285301 1190285324
Species Human (GRCh38) Human (GRCh38)
Location X:48957467-48957489 X:48957515-48957537
Sequence CCTCCGCCGCGCCGCGGCGCCGG TCGTTGGCGGGGTCGGCGTCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 62, 4: 625} {0: 1, 1: 0, 2: 1, 3: 2, 4: 71}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!