ID: 1190285307_1190285314

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1190285307 1190285314
Species Human (GRCh38) Human (GRCh38)
Location X:48957473-48957495 X:48957488-48957510
Sequence CCGCGCCGCGGCGCCGGGGGCAT GGGGGCATCGGCCCGGGCGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 110} {0: 1, 1: 0, 2: 0, 3: 35, 4: 631}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!