ID: 1190285316_1190285325

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1190285316 1190285325
Species Human (GRCh38) Human (GRCh38)
Location X:48957499-48957521 X:48957518-48957540
Sequence CCCGGGCGGCGGCGGCTCGTTGG TTGGCGGGGTCGGCGTCGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 114} {0: 1, 1: 0, 2: 1, 3: 14, 4: 150}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!