ID: 1190610009_1190610019

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1190610009 1190610019
Species Human (GRCh38) Human (GRCh38)
Location X:52184741-52184763 X:52184773-52184795
Sequence CCCACCCGCGGAATCGCATGCGC CTGGAGGAAAGGGCTTTTGTTGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 0, 4: 13} {0: 2, 1: 0, 2: 5, 3: 25, 4: 334}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!