ID: 1190640691_1190640697

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1190640691 1190640697
Species Human (GRCh38) Human (GRCh38)
Location X:52481187-52481209 X:52481203-52481225
Sequence CCCTCTTGGCCCTGCTCTACAGA CTACAGAAAATGATGGAGCAGGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 4, 3: 20, 4: 227} {0: 2, 1: 0, 2: 0, 3: 30, 4: 300}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!