|
Left Crispr |
Right Crispr |
| Crispr ID |
1190697268 |
1190697271 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
X:52959364-52959386
|
X:52959398-52959420
|
| Sequence |
CCGGACAGACTCCATTTTAGTTT |
GCCCCCTTTATCCCCCTTAAGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 23, 1: 16, 2: 9, 3: 33, 4: 360} |
{0: 6, 1: 0, 2: 1, 3: 5, 4: 68} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|