ID: 1190862617_1190862634

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1190862617 1190862634
Species Human (GRCh38) Human (GRCh38)
Location X:54358594-54358616 X:54358647-54358669
Sequence CCCAGTTACGTTGCGGGGGCAAC ACCGCAGTGCGCGCGCGCGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 8} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!