ID: 1191006529_1191006536

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1191006529 1191006536
Species Human (GRCh38) Human (GRCh38)
Location X:55716183-55716205 X:55716214-55716236
Sequence CCAGCACTTTCCTGCCCCGCTCC AAGCTGGTGCATCTGAATGCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 10, 3: 45, 4: 176}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!