ID: 1191619512_1191619518

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1191619512 1191619518
Species Human (GRCh38) Human (GRCh38)
Location X:63201261-63201283 X:63201295-63201317
Sequence CCACTCAAGGCCTGCTCTCCAGA CATGGGGTGTTCCCTTGATGTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!