ID: 1191620393_1191620403

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1191620393 1191620403
Species Human (GRCh38) Human (GRCh38)
Location X:63209991-63210013 X:63210022-63210044
Sequence CCCTGTCCCCCTTCTCTCAGGGG TCCACAGGATAGATTGTCAGGGG
Strand - +
Off-target summary No data {0: 2, 1: 0, 2: 0, 3: 9, 4: 112}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!