ID: 1191640511_1191640519

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1191640511 1191640519
Species Human (GRCh38) Human (GRCh38)
Location X:63426658-63426680 X:63426680-63426702
Sequence CCCGGGCAGGAGAGGTCTGGGAT TTGTTGTGAAAATGGGGTGGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 34, 4: 327}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!