ID: 1192130383_1192130389

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1192130383 1192130389
Species Human (GRCh38) Human (GRCh38)
Location X:68544096-68544118 X:68544113-68544135
Sequence CCTGCCAGGCAGCAGTTAGAAGT AGAAGTAGGGGAAGACAAAAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 158, 4: 828}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!