ID: 1192147809_1192147824

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1192147809 1192147824
Species Human (GRCh38) Human (GRCh38)
Location X:68693708-68693730 X:68693739-68693761
Sequence CCCCTGCCCGACCCCAGGCCCCG CCGGACGGAGCAGTCCCTCCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 10, 3: 105, 4: 1106} {0: 1, 1: 0, 2: 1, 3: 8, 4: 124}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!