ID: 1192203495_1192203507

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1192203495 1192203507
Species Human (GRCh38) Human (GRCh38)
Location X:69081841-69081863 X:69081876-69081898
Sequence CCTGGCTCCCAGGGTTACTCCCC ACCCCCAGAGGCAGTGTCCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 250} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!