ID: 1192235917_1192235923

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1192235917 1192235923
Species Human (GRCh38) Human (GRCh38)
Location X:69296037-69296059 X:69296060-69296082
Sequence CCCTCCCCACGCTTGTGGAATTC ATCAGCGAAGTGTCAGAGGCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 8, 4: 129}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!