ID: 1192516330_1192516333

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1192516330 1192516333
Species Human (GRCh38) Human (GRCh38)
Location X:71763972-71763994 X:71763985-71764007
Sequence CCTCCGCGTGGATCCCCAGCAGC CCCCAGCAGCCCTCTGCGAAAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 7, 4: 128} {0: 2, 1: 0, 2: 2, 3: 14, 4: 197}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!