ID: 1192520481_1192520494

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1192520481 1192520494
Species Human (GRCh38) Human (GRCh38)
Location X:71796270-71796292 X:71796313-71796335
Sequence CCATGGCCAGGCCGCTCCCTCAG CATGAACCAAGCCTGCGTTGGGG
Strand - +
Off-target summary No data {0: 2, 1: 0, 2: 0, 3: 6, 4: 58}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!