ID: 1192547022_1192547027

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1192547022 1192547027
Species Human (GRCh38) Human (GRCh38)
Location X:72022648-72022670 X:72022671-72022693
Sequence CCCGTACCATCTCACTGGGGAGT AGGGTTTCAACATATGAAGAAGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 67, 3: 518, 4: 1557}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!