ID: 1192777049_1192777052

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1192777049 1192777052
Species Human (GRCh38) Human (GRCh38)
Location X:74256010-74256032 X:74256047-74256069
Sequence CCAGCAAAGCGGTCAGTGGCAAA TCCATCTTGTTTCATGTCTTTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!