ID: 1193165692_1193165700

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1193165692 1193165700
Species Human (GRCh38) Human (GRCh38)
Location X:78277550-78277572 X:78277587-78277609
Sequence CCTTGGTTCCTCCAGCACAGCAG GGGACCAGTGAAAAAATTGTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 15, 4: 167}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!