ID: 1193715144_1193715151

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1193715144 1193715151
Species Human (GRCh38) Human (GRCh38)
Location X:84928093-84928115 X:84928134-84928156
Sequence CCCATTTGGGAGGTCCTGCCCAG GGCACCTGCTCAAAGAAGTCTGG
Strand - +
Off-target summary {0: 5, 1: 10, 2: 86, 3: 133, 4: 291} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!