ID: 1193808371_1193808372

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1193808371 1193808372
Species Human (GRCh38) Human (GRCh38)
Location X:86021197-86021219 X:86021210-86021232
Sequence CCGAAGCACTTCGGGTCCCAAGC GGTCCCAAGCATTTCAGATAAGG
Strand - +
Off-target summary {0: 1, 1: 4, 2: 177, 3: 328, 4: 469} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!