ID: 1194270701_1194270704

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1194270701 1194270704
Species Human (GRCh38) Human (GRCh38)
Location X:91811084-91811106 X:91811097-91811119
Sequence CCTGCCATGGAACCTCCTATCTA CTCCTATCTAGTGCAGCATTTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!