ID: 1194388921_1194388926

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1194388921 1194388926
Species Human (GRCh38) Human (GRCh38)
Location X:93292418-93292440 X:93292440-93292462
Sequence CCATCCAGCCATCCAACACAGAG GAGACTGTGCACTTGAAAGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 342} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!