ID: 1195846527_1195846534

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1195846527 1195846534
Species Human (GRCh38) Human (GRCh38)
Location X:109235014-109235036 X:109235044-109235066
Sequence CCAGACCCCACTTTCAGCACTGG AATTCAACATGAGATTTGAGTGG
Strand - +
Off-target summary No data {0: 103, 1: 1835, 2: 11362, 3: 14611, 4: 11691}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!