ID: 1195846527_1195846536

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1195846527 1195846536
Species Human (GRCh38) Human (GRCh38)
Location X:109235014-109235036 X:109235046-109235068
Sequence CCAGACCCCACTTTCAGCACTGG TTCAACATGAGATTTGAGTGGGG
Strand - +
Off-target summary No data {0: 97, 1: 1784, 2: 10938, 3: 13095, 4: 9677}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!