ID: 1195999056_1195999059

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1195999056 1195999059
Species Human (GRCh38) Human (GRCh38)
Location X:110761583-110761605 X:110761596-110761618
Sequence CCATGTCTGGAGACATTTTTGGT CATTTTTGGTTATTAGGATTGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!