ID: 1196004620_1196004630

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1196004620 1196004630
Species Human (GRCh38) Human (GRCh38)
Location X:110822419-110822441 X:110822472-110822494
Sequence CCCTCCGAGCCAGTTGCGGGATA GTTGGAAAAGCACAGTATTCGGG
Strand - +
Off-target summary No data {0: 14, 1: 380, 2: 1444, 3: 1934, 4: 2381}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!