ID: 1196135966_1196135972

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1196135966 1196135972
Species Human (GRCh38) Human (GRCh38)
Location X:112209830-112209852 X:112209875-112209897
Sequence CCAAAGCCCAGTAACAGTCCAAG AGTTATCTGCAGAAGATGGCAGG
Strand - +
Off-target summary No data {0: 185, 1: 187, 2: 104, 3: 111, 4: 225}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!