ID: 1196545706_1196545712

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1196545706 1196545712
Species Human (GRCh38) Human (GRCh38)
Location X:116962315-116962337 X:116962359-116962381
Sequence CCTTGCTGAGCTGTGGTGGGGTC CTGCTTTGTTTACACTGTGAGGG
Strand - +
Off-target summary No data {0: 15, 1: 247, 2: 607, 3: 415, 4: 394}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!