ID: 1196740178_1196740185

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1196740178 1196740185
Species Human (GRCh38) Human (GRCh38)
Location X:119017723-119017745 X:119017769-119017791
Sequence CCCCACTGCCGTCGGGGGGAGTC AATAATATCTTAACAGAAGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 55} {0: 1, 1: 0, 2: 3, 3: 32, 4: 280}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!