ID: 1196749508_1196749510

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1196749508 1196749510
Species Human (GRCh38) Human (GRCh38)
Location X:119102409-119102431 X:119102442-119102464
Sequence CCAGGTGGAAGTACAGTGGCTAC GATCATAGTGCACTACAGCCTGG
Strand - +
Off-target summary No data {0: 3, 1: 10, 2: 54, 3: 410, 4: 1441}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!