ID: 1197002284_1197002292

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1197002284 1197002292
Species Human (GRCh38) Human (GRCh38)
Location X:121452889-121452911 X:121452937-121452959
Sequence CCTGTCATCTTCTGCAGATAACT CATGGTCTGTTACTGGGCCTTGG
Strand - +
Off-target summary {0: 21, 1: 199, 2: 184, 3: 120, 4: 249} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!