ID: 1197097465_1197097466

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1197097465 1197097466
Species Human (GRCh38) Human (GRCh38)
Location X:122612810-122612832 X:122612827-122612849
Sequence CCATCTTCTGCAGATAACTATTC CTATTCTCCTTTTGAGAGACAGG
Strand - +
Off-target summary {0: 14, 1: 194, 2: 203, 3: 139, 4: 330} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!